|
Applied StemCell Inc
single guide rnas 5g and 3g Single Guide Rnas 5g And 3g, supplied by Applied StemCell Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/single+guide+rnas+5g+and+3g/pmc09792899-283-0-26 Average 90 stars, based on 1 article reviews
single guide rnas 5g and 3g - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
single-guide rnas targeting sting1 (sg sting1 -1: gtacccaatgtagtatgacc) Single Guide Rnas Targeting Sting1 (Sg Sting1 1: Gtacccaatgtagtatgacc), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/single+guide+rnas+targeting+sting1++sg+sting1++1++gtacccaatgtagtatgacc+/pmc12046326-225-0-11 Average 90 stars, based on 1 article reviews
single-guide rnas targeting sting1 (sg sting1 -1: gtacccaatgtagtatgacc) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
genome-wide lentiviral human crispr knockout guide library with 58 028 single-guide rnas (sgrnas) Genome Wide Lentiviral Human Crispr Knockout Guide Library With 58 028 Single Guide Rnas (Sgrnas), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/genome+wide+lentiviral+human+crispr+knockout+guide+library+with+58+028+single+guide+rnas++sgrnas+/pm35903686-58-18-32 Average 90 stars, based on 1 article reviews
genome-wide lentiviral human crispr knockout guide library with 58 028 single-guide rnas (sgrnas) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
single guide rnas targeting the beginning of the largest exon 8 Single Guide Rnas Targeting The Beginning Of The Largest Exon 8, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/single+guide+rnas+targeting+the+beginning+of+the+largest+exon+8/pmc07092968-55-14-25 Average 90 stars, based on 1 article reviews
single guide rnas targeting the beginning of the largest exon 8 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
ToolGen Incorporated
y105c5a.1272 targeting single-guide rnas (sgrnas) Y105c5a.1272 Targeting Single Guide Rnas (Sgrnas), supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/y105c5a+1272+targeting+single+guide+rnas++sgrnas+/pmc05561207-148-9-22 Average 90 stars, based on 1 article reviews
y105c5a.1272 targeting single-guide rnas (sgrnas) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Benchling Inc
vero cells single guide rna sgrna sequences targeting dhhc11 Vero Cells Single Guide Rna Sgrna Sequences Targeting Dhhc11, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/guide+rnas+sgrnas+single+usp18/pm41223056-376-4-21 Average 86 stars, based on 1 article reviews
vero cells single guide rna sgrna sequences targeting dhhc11 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
single guide rnas sgrnas Single Guide Rnas Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/guide+rnas+sgrnas+single/pm42129160-1135-0-10 Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Shanghai Genechem Ltd
single guide rnas sgrnas ![]() Single Guide Rnas Sgrnas, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/guide+rnas+sgrnas+single/pmc12738560-453-10-16 Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Beijing SyngenTech Co
single-guide rnas (sgrnas) targeting enhancer regions around the foxf2 genomic locus ![]() Single Guide Rnas (Sgrnas) Targeting Enhancer Regions Around The Foxf2 Genomic Locus, supplied by Beijing SyngenTech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/single+guide+rnas++sgrnas++targeting+enhancer+regions+around+the+foxf2+genomic+locus/pm39828125-121-8-27 Average 90 stars, based on 1 article reviews
single-guide rnas (sgrnas) targeting enhancer regions around the foxf2 genomic locus - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Genomatix gmbh
single-guide rnas ![]() Single Guide Rnas, supplied by Genomatix gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/single+guide+rnas/pm31025379-69-11-44 Average 90 stars, based on 1 article reviews
single-guide rnas - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
ToolGen Incorporated
single-guide (sg)rnas ![]() Single Guide (Sg)rnas, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/single+guide++sg+rnas/pm35835952-38-7-16 Average 90 stars, based on 1 article reviews
single-guide (sg)rnas - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Rauscher GmbH
single guide rnas ![]() Single Guide Rnas, supplied by Rauscher GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/single-guide+rnas/single+guide+rnas/pm28766239-96-11-24 Average 90 stars, based on 1 article reviews
single guide rnas - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Nature Communications
Article Title: Endothelial RAB5IF is required for pathological and developmental retinal angiogenesis
doi: 10.1038/s41467-025-66212-x
Figure Lengend Snippet: A The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-GFP viral particles (7 × 10 10 viral particles/0.5 µL/mouse), followed by frozen sections and flat mount staining 21 days later to observe GFP-positive infection area. Scale bar = 100 μm / 50 μm. B – H The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-sgRAB5IF (RAB5IF-eCKO#1 and RAB5IF-eCKO#2, encoding non-overlapping sgRNAs against murine RAB5IF ) or AAV5-FLEX-sgRNA control viral particles (“sgC), both at 7 × 10 10 viral particles/0.5 µL/mouse; After 21 days RAB5IF protein expression in the primary mRMECs extracted from adult mice was shown (pooled from 4 mice/sample, n = 5 samples/group, 15 μg protein/lane for WB) ( B ); IB4 staining of retinal flat mounts, showing representative images, and quantification of vascular branch numbers. Scale bar = 100 μm ( C ). PAS staining of retinal tissue, showing representative images, and quantification of acellular capillary numbers. Scale bar = 60 μm ( D ). Evans blue (EB) leakage assay assessing retinal vascular leakage, showing representative images, and quantification of EB leakage. Scale bar = 1 mm ( E ). Tubb3/NeuN double staining of retinal flat mounts to label RGCs, showing representative images, and quantification of Tubb3 + /NeuN + cell numbers. Scale bar = 60 μm ( F ). RBPMS staining of retinal sections to label RGCs, showing representative images, and quantification of RBPMS + cell numbers. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar = 200 μm ( G ). Expression of listed neuronal marker proteins in the retinal tissues was also tested (individual samples, n = 5 mice/group, 15 μg protein/lane) ( H ). I At P1, endothelial-targeted AAV (1 × 10 11 viral particles/7.5 µL/mouse) was injected retro-orbitally for RAB5IF knockdown (RAB5IF-eKD). Subsequently, listed neuronal markers were detected by Western blot at P6. (pooled from 8 mice/sample, n = 8 samples/group, 15 μg protein/lane for WB). Data are presented as means ± S.D; One-way ANOVA with Bonferroni’s post hoc test. n = 5 mice per group. Source data are provided as a Source Data file.
Article Snippet: For in vitro studies, lentiviral short hairpin RNAs (shRNAs) and
Techniques: Injection, Staining, Infection, Control, Expressing, Double Staining, Marker, Knockdown, Western Blot
Journal: Nature Communications
Article Title: Endothelial RAB5IF is required for pathological and developmental retinal angiogenesis
doi: 10.1038/s41467-025-66212-x
Figure Lengend Snippet: A – E The human retinal microvascular endothelial cells (hRMECs) expressing the applied RAB5IF shRNAs (shRAB5IF#1, shRAB5IF#2 and shRAB5IF#3, with different shRNA sequences against RAB5IF ) or the scramble control shRNA (shC) were established, expression of RAB5IF mRNA and protein was shown ( n = 5 biological repeats, 15 μg protein/lane for WB) ( A ); Cells were further cultured for the indicated time periods, sprouting ( B ), cell proliferation (by testing EdU-positive nuclei ratio, C ), migration (Transwell assays, D ) and the capillary tube formation ( E ) were tested by the listed assays. F – J Stable hRMECs expressing the listed lentiviral CRISPR/Cas9-RAB5IF-KO construct (koRAB5IF#1/koRAB5IF#2, with different sgRNA sequences against RAB5IF ) or the control construct with non-sense sgRNA (koC) were established, and RAB5IF protein expression was tested ( n = 5 biological repeats, 15 μg protein/lane for WB) ( F ); Cells were further cultured for the indicated time periods, sprouting ( G ), cell proliferation (by testing EdU-positive nuclei ratio, H ), migration (Transwell assays, I ) and the capillary tube formation ( J ) and were tested. K , L Stable hRMECs with the designated genetic modifications on RAB5IF were cultured and subjected to Seahorse analyses to evaluate oxidative phosphorylation ( K ) and glycolysis ( L ). M – R Stable hRMECs with the lentiviral RAB5IF-expressing construct (oeRAB5IF-Sl1/oeRAB5IF-Sl2, two stable cell selections) or the empty vector (Vec) were established, expression of RAB5IF mRNA and protein was shown ( n = 5 biological repeats, 15 μg protein/lane for WB) ( M ); Cells were further cultured for the indicated time periods, sprouting ( N ), cell proliferation (by testing EdU-positive nuclei ratio, O ) and migration (Transwell assays, P ) were tested, with results quantified. Seahorse assays were also carried out to evaluate ATP contents ( Q ) and basal glycolysis levels ( R ). Data are presented as means ± S.D., n = 5 (biological repeats). “N.S.” indicates no statistical difference ( P > 0.05); One-way ANOVA with Bonferroni’s post hoc test. Scale bars = 100/200 μm. Source data are provided as a Source Data file.
Article Snippet: For in vitro studies, lentiviral short hairpin RNAs (shRNAs) and
Techniques: Expressing, shRNA, Control, Cell Culture, Migration, CRISPR, Construct, Phospho-proteomics, Stable Transfection, Plasmid Preparation